Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis elegans cel-miR-238-3p URS0000594984_6239

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cel-mir-238: Cel-mir-238 is a synthesized C. elegans miRNA that was used as an internal calibrator in a study involving plasma samples [PMC5609864]. It was one of three miRNAs, along with cel-miR-39 and cel-miR-54, that were spiked into the samples [PMC5609864]. The purpose of using cel-mir-238 as an internal calibrator was to calculate the relative expression level of target miRNAs in the samples [PMC4014722]. The relative expression level was determined by calculating the difference in CT values between the target miRNA and cel-mir-238 [PMC4014722]. This calculation allowed for the quantification and comparison of target miRNA expression levels [PMC4014722]. The use of cel-mir-238 as an internal calibrator is a common practice in qRT-PCR experiments to ensure accurate and reliable measurements [PMC5609864]. By using synthesized C. elegans miRNAs like cel-mir-238, researchers can control for experimental variability and normalize their data [PMC5609864]. This approach allows for more accurate interpretation of qRT-PCR results and facilitates comparisons between different samples or experimental conditions [PMC5609864].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUACUCCGAUGCCAUUCAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Caenorhabditis brenneri cbn-miR-238
Publications