Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-24-3p URS000059273E_9606

mRNA interactions 16 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCUCAGUUCAGCAGGAACAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 51 other species

  1. Alligator mississippiensis (American alligator) ami-miR-24-3p
  2. Anolis carolinensis aca-miR-24-3p
  3. Bos taurus bta-miR-24-3p
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-24
  5. Callorhinchus milii (elephant shark) Cmi-Mir-24-P2_3p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-24-P2_3p (mature (guide))
  7. Capra hircus miR-24
  8. Cavia porcellus cpo-miR-24-3p
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-24-P2_3p (mature (guide))
  10. Cyprinus carpio (common carp) ccr-miR-24
  11. Danio rerio dre-miR-24
  12. Dasypus novemcinctus dno-miR-24a-3p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-24-P2_3p (mature (guide))
  14. Eptatretus burgeri Ebu-Mir-24-P5_3p (mature (guide))
  15. Equus caballus (horse) eca-miR-24
  16. Gadus morhua Gmo-Mir-24-P2b_3p (mature (guide))
  17. Gallus gallus (chicken) gga-miR-24-3p
  18. Gorilla gorilla gorilla ggo-miR-24 (MIR24)
  19. Gorilla gorilla ggo-miR-24
  20. Haplochromis burtoni abu-miR-24b-3p
  21. Latimeria chalumnae Lch-Mir-24-P2_3p (mature (guide))
  22. Lepisosteus oculatus Loc-Mir-24-P2_3p (mature (guide))
  23. Macaca mulatta (Rhesus monkey) mml-miR-24-3p
  24. Macaca nemestrina mne-miR-24-3p
  25. Microcaecilia unicolor Mun-Mir-24-P3b_3p (mature (guide))
  26. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-24-P2_3p (mature (guide))
  27. Mus musculus (house mouse) mmu-miR-24-3p
  28. Neolamprologus brichardi nbr-miR-24a
  29. Oreochromis niloticus (Nile tilapia) oni-miR-24a
  30. Ornithorhynchus anatinus (platypus) oan-miR-24-3p
  31. Oryctolagus cuniculus (rabbit) ocu-miR-24-3p
  32. Oryzias latipes ola-miR-24a
  33. Ovis aries miscellaneous RNA
  34. Pan paniscus (pygmy chimpanzee) ppa-miR-24-3p
  35. Pan troglodytes (chimpanzee) ptr-miR-24
  36. Petromyzon marinus (sea lamprey) pma-miR-24
  37. Pongo pygmaeus ppy-miR-24-3p
  38. Pundamilia nyererei pny-miR-24a
  39. Python bivittatus pbv-miR-24-3p
  40. Rattus norvegicus rno-miR-24-3p
  41. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-24-P2_3p (mature (guide))
  42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-24-P1_3p (mature (guide))
  43. Sphenodon punctatus Spt-Mir-24-P2_3p (mature (guide))
  44. Sus scrofa ssc-miR-24-3p
  45. Taeniopygia guttata tgu-miR-24-3p
  46. Takifugu rubripes fru-miR-24-3p
  47. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-24
  48. Tor tambroides miR-24
  49. Tursiops truncatus (common bottlenose dolphin) miR-24-3p
  50. Xenopus laevis (African clawed frog) xla-miR-24a-3p
  51. Xenopus tropicalis (tropical clawed frog) xtr-miR-24a-3p
Publications