Homo sapiens (human) hsa-miR-320b

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-320b URS000058BF17_9606

22 nucleotides
8 databases (ENA, GeneCards, LncBase, MalaCards, miRBase, MirGeneDB, RefSeq, TarBase)
Found in 5 other species
302 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-320b: Hsa-mir-320b is one of the 11 miRNAs that were identified as differentially expressed in a study [PMC7027243]. It has been found to play a role in restraining NPC (nasopharyngeal carcinoma) cell proliferation and enhancing mitochondrial fragmentation and apoptosis [PMC8224659]. Hsa-mir-320b achieves this by targeting TP53 regulated inhibitor of apoptosis 1 (TRIAP1), which is a TP53-regulated inhibitor of apoptosis [PMC8224659]. The study found intergroup differences in the expression of hsa-mir-320b, along with other miRNAs, in FR (Fisher ratio) analysis [PMC7027243]. The expression of hsa-mir-320b was shown to have an impact on NPC cell proliferation and apoptosis both in vitro and in vivo, suggesting its potential as a therapeutic target for NPC treatment [PMC8224659].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAAAGCUGGGUUGAGAGGGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.