Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-125b precursor (hsa-mir-125b-2) URS000058997A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR125B2: MIR125B2 is a gene that was identified through the analysis of SNP sites in the genomic DNAs of offspring [PMC10014956]. This gene, along with other genes such as COL11A1, COL12A1, CATSPER2, KCNJ12, GP6 (ENSG00000088053), MIR99A (ENSG00000207638), MIR99AHG (ENSG00000215386), MIRLET7C (ENSG00000199030), and LINC01250, was selected based on its potential pathogenicity for ACL rupture and its shared regions in affected family members [PMC9536556]. These genes were also chosen because they have been previously associated with ACL rupture and have shared biology/function [PMC9536556]. The identification of SNP sites in the offspring's genomic DNAs allowed for the determination of the imprinting status of MIR125B2 [PMC10014956]. The selection of these specific genes was based on their potential role in ACL rupture and their shared characteristics with previously identified associated genes [PMC9536556]. This approach allowed for a comprehensive analysis that considered both genetic factors and shared biology/function in order to identify potential pathogenic genes related to ACL rupture.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUAUUUUAGUAACAUCACAAGUCAGGCUCUUGGGACCUAGGCGGAGGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 63 other species

  1. Ailuropoda melanoleuca microRNA 125b-2 (ENSAMEG00000022531.2)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-125b precursor (age-mir-125b-2)
  3. Balaenoptera musculus microRNA 125b-2 (ENSBMSG00010015149.1)
  4. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000027577.3)
  5. Camelus dromedarius microRNA 125b-2 (ENSCDRG00005000017.1)
  6. Canis lupus dingo (dingo) microRNA 125b-2 (ENSCAFG00020026403.1)
  7. Canis lupus familiaris miRNA (ENSCAFG00000020578.2, ENSCAFG00030007692.1, ENSCAFG00040025941.1, ENSCAFG00845024575.1)
  8. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000019734.2)
  9. Castor canadensis miRNA (ENSCCNG00000014735.1)
  10. Catagonus wagneri (Chacoan peccary) microRNA 125b-2 (ENSCWAG00000019303.1)
  11. Cebus imitator microRNA 125b-2 (ENSCCAG00000020359.1)
  12. Cercocebus atys miRNA (ENSCATG00000019774.1)
  13. Chlorocebus sabaeus microRNA 125b-2 (ENSCSAG00000025446.1)
  14. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000013865.1)
  15. Dasypus novemcinctus miRNA (ENSDNOG00000028106.1)
  16. Delphinapterus leucas microRNA 125b-2 (ENSDLEG00000009449.1)
  17. Echinops telfairi (small Madagascar hedgehog) miRNA (ENSETEG00000021222.1)
  18. Erinaceus europaeus (western European hedgehog) miRNA (ENSEEUG00000016001.1)
  19. Felis catus microRNA 125b-2 (ENSFCAG00000024651.3)
  20. Gorilla gorilla gorilla ggo-mir-125b-2 (ENSGGOG00000033475.2)
  21. Gorilla gorilla microRNA ggo-mir-125b precursor (ggo-mir-125b-2)
  22. Heterocephalus glaber microRNA 125b-2 (ENSHGLG00000022569.2, ENSHGLG00100023535.2)
  23. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-125b precursor (lla-mir-125b-2)
  24. Lemur catta microRNA lca-mir-125b precursor
  25. Loxodonta africana microRNA 125b-2 (ENSLAFG00000024899.1)
  26. Lynx canadensis (Canada lynx) microRNA 125b-2 (ENSLCNG00005011093.1)
  27. Macaca fascicularis (Crab-eating macaque) microRNA 125b-2 (ENSMFAG00000006263.2)
  28. Macaca mulatta microRNA mml-mir-125b precursor (mml-mir-125b-2)
  29. Macaca nemestrina microRNA mne-mir-125b precursor (mne-mir-125b-2)
  30. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000010962.1)
  31. Marmota marmota marmota miRNA (ENSMMMG00000010541.1, ENSMMMG00000017025.1)
  32. Microcebus murinus (gray mouse lemur) microRNA 125b-2 (ENSMICG00000033176.2)
  33. Monodon monoceros (narwhal) microRNA 125b-2 (ENSMMNG00015000163.1)
  34. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 125b-2 (ENSNLEG00000023414.2)
  35. Oryctolagus cuniculus microRNA 125b-2 (ENSOCUG00000019177.1)
  36. Pan paniscus microRNA 125b-2 (ENSPPAG00000021257.1)
  37. Panthera leo microRNA 125b-2 (ENSPLOG00000017567.1)
  38. Panthera pardus microRNA 125b-2 (ENSPPRG00000014246.1)
  39. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002187.1)
  40. Pan troglodytes (chimpanzee) microRNA ptr-mir-125b precursor (ptr-mir-125b-2)
  41. Papio anubis miRNA (ENSPANG00000002261.3)
  42. Phocoena sinus (vaquita) microRNA 125b-2 (ENSPSNG00000012444.1)
  43. Physeter catodon (sperm whale) microRNA 125b-2 (ENSPCTG00005021090.1)
  44. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000021257.2)
  45. Pongo pygmaeus microRNA ppy-mir-125b precursor (ppy-mir-125b-2)
  46. Prolemur simus miRNA (ENSPSMG00000014287.1)
  47. Propithecus coquereli miRNA (ENSPCOG00000010806.1)
  48. Pteropus vampyrus miRNA (ENSPVAG00000025451.1)
  49. Rhinopithecus bieti miRNA (ENSRBIG00000020283.1)
  50. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000028130.1)
  51. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000006828.1)
  52. Sciurus vulgaris microRNA 125b-2 (ENSSVLG00005016255.1)
  53. Spermophilus dauricus miRNA (ENSSDAG00000002771.1)
  54. Sus scrofa (pig) microRNA ssc-mir-125b precursor (ssc-mir-125b-2)
  55. Theropithecus gelada (gelada) microRNA 125b-2 (ENSTGEG00000000963.1)
  56. Tursiops truncatus miRNA (ENSTTRG00000024083.1)
  57. Urocitellus parryii miRNA (ENSUPAG00010019619.1)
  58. Ursus americanus (American black bear) miRNA (ENSUAMG00000009795.1)
  59. Ursus maritimus miRNA (ENSUMAG00000014529.1)
  60. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 125b-2 (ENSUTTG00000004809.1)
  61. Vicugna pacos miRNA (ENSVPAG00000016707.1, ENSVPAG00000016744.1)
  62. Vulpes vulpes miRNA (ENSVVUG00000023895.1)
  63. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015002668.1)
Publications