Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 95 (SNORD95) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 95 (SNORD95) URS0000571896_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD95: SNORD95 is a snoRNA (small nucleolar RNA) that was used as a primer assay in pre-amplification control experiments for RT-qPCR [PMC4494926]. It was also used as a normalization factor in real-time RT-PCR experiments to account for variability in sample loading and efficiency [PMC7764659]. The cycle conditions for the experiments were 95°C for 15 min and 40 cycles of 95°C for 15 s, 55°C for 30 s, and 70°C for 30 s [PMC7764659]. SNORD95, along with RNU6-2 (a snRNA) were used as normalization factors in the analysis of the data [PMC3743798]. The data analysis was performed in Excel using Ct values, which were normalized to the average Ct of five miRNA housekeeping controls (SNORD61, SNORD68, SNORD72, SNORD95, SNORD96A, RNU6-2) [PMC5941588]. In summary, SNORD95 is a snoRNA that has been utilized as a primer assay and normalization factor in various experimental techniques such as RT-qPCR and real-time RT-PCR. It has been used to control variability in sample loading and efficiency. Additionally, it has been included as one of the housekeeping controls during data analysis. These references provide evidence of the use of SNORD95 in experimental procedures and its importance in ensuring accurate results.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGUGAUGACCCCAACAUGCCAUCUGAGUGUCGGUGCUGAAAUCCAGAGGCUGUUUCUGAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications