Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-5099 URS000056F567_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-5099: Mmu-mir-5099 is a microRNA that has been identified in various studies. It has been found to be upregulated in nonunion formation [PMC6641081], downregulated after HDAC4 inhibition [PMC9347038], upregulated after cerebral ischemia-reperfusion [PMC6798056], and downregulated with syncytial differentiation [PMC6366741]. However, qrt-PCR analysis could not show significant differences in gene expression rate for mmu-mir-5099 in nonunion formation [PMC6641081]. It has also been identified as one of the intersected miRNAs that are downregulated after HDAC4 inhibition and denervation [PMC9347038]. In the context of ischemic stroke, mmu-mir-5099 is one of the miRNAs that may serve as a biomarker for the third day after stroke onset [PMC6798056]. In syncytial differentiation, mmu-mir-5099 is significantly downregulated compared to trophoblast stem cells (TSC) [PMC6366741]. Furthermore, quantitative overlap analysis showed that mmu-mir-5099 is one of the oppositely regulated miRNAs between male and female profiles [PMC5179560]. These findings suggest that mmu-mir-5099 may play a role in various biological processes and could potentially serve as a biomarker for certain conditions. However, further research is needed to fully understand its functions and mechanisms of action.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAGAUCGAUGUGGUGCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications