Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Leu (CUN) 2 (MT-TL2) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Leu (CUN) 2 (MT-TL2) URS000056BD99_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TL2: MT-TL2 is a mitochondrial tRNA that recognizes codons CUN [PMC9648901]. Four mutations in the mitochondrial genome, including the m.12315G>A mutation in the MT-TL2 gene, have been found to be more prevalent in lipofibrous plaques associated with atherosclerosis development [PMC7344641]. Phylogenetic conservation analysis has shown that the A nucleotide at position 44 of MT-TL2 gene is highly conserved with a conservation index of 100% [PMC9762579]. MT-TL2 is one of the 10 most suppressed transcripts after Cvs [PMC10060325]. A patient with exercise intolerance and chronic progressive external ophthalmoplegia (CPEO) was found to have a m.12,294G > A mutation in the MT-TL2 gene [PMC5649050]. In female mice injected with rhPRG4, upregulated genes included MT-TL2 [PMC9025840]. These mutations are localized in genes such as MT-RNR1, MT-ND1, MT-ND6, and MT-CYTB [PMC5603332].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUUUUAAAGGAUAACAGCUAUCCAUUGGUCUUAGGCCCCAAAAAUUUUGGUGCAACUCCAAAUAAAAGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Cloning vector pRS316-1B9 tRNA-Leu
  2. Homo sapiens neanderthalensis transfer RNA-Leu
2D structure Publications