v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small Cajal body-specific RNA 10 (SCARNA10) secondary structure diagram

Homo sapiens (human) small Cajal body-specific RNA 10 (SCARNA10) URS0000569A4A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA10: SCARNA10 is a type of RNA molecule that has been studied in relation to liver fibrosis and hepatocellular carcinoma (HCC) [PMC6587170]. Knockdown of SCARNA10 has been found to suppress the progression of liver fibrosis, while over-expression of SCARNA10 aggravates it [PMC6587170]. This suggests that SCARNA10 may have a role in the development and progression of liver fibrosis [PMC6587170]. Additionally, it has been proposed that SCARNA10 could serve as a potential diagnostic biomarker for HCC [PMC9022341]. Sequence homology searches have revealed the presence of an orthologous SCARNA10 transcript in the human genome, further supporting its relevance [PMC6587170]. Furthermore, experiments using immunofluorescence have shown that when hepatic stellate cells (HSCs) are transfected with SCARNA10 siRNA, the expression of α-SMA and Col1α1, which are markers associated with liver fibrosis, is decreased [PMC6587170]. This suggests that targeting SCARNA10 could potentially be a therapeutic strategy for liver fibrosis [PMC6587170]. Overall, these findings highlight the importance of SCARNA10 in liver fibrosis and HCC development and provide insights into its potential diagnostic and therapeutic applications [PMC6587170][PMC9022341].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCACAUGAUGAUAUCAAGGCUGUUGUGAUUCAGUUGGUUUGGCUAAGCCCAGGGACCUUUGGCCUGUUAAAGGUCUGUAAUCUUGGUGGGCGAUACAGAGUUAUGUGUGUUCACUGUAAGGGCAGACCAACAAGAACUUUUUCCUACUUUUGAGCUACCUCUUUUUAAUAGGGGUGAUUCUUCCAGUUGCUGGAGAGAAAUUGUGGUAACUGGAGUGAGAGAGUAGGAACAGGGCAUGUUCAGGGUAUCAGGGCCAAGGGUCCUAAAGGACUUAGCUUGUGUUAUGGCCACUGAGAGAUGAAACACAGAUCUUUGGUAAUCUGAUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications