Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1262 URS0000568FF8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1262: hsa-mir-1262 is a microRNA that has been identified as a potential biomarker for the earlier and more precise diagnosis of treatment-resistant schizophrenia (TRS) [PMC7533444]. It is a small non-coding RNA molecule that plays a role in gene regulation and has been found to be dysregulated in various diseases [PMC7533444]. In the context of TRS, hsa-mir-1262 has been proposed as one of the major biomarkers, along with hsa-miR-218-5p, for improving diagnosis and treatment [PMC7533444]. In terms of target genes, hsa-miR-218-5p was found to have 187 predicted target genes, while hsa-mir-1262 had only 51 target genes identified [PMC7533444]. These target genes are potential candidates for further investigation into the underlying mechanisms of TRS and could potentially be targeted for gene-based diagnosis and treatment strategies [PMC7533444]. Overall, the identification of hsa-mir-1262 as a potential biomarker for TRS opens up new possibilities for improving diagnostic accuracy and developing more targeted treatment approaches. Further research is needed to fully understand the role of hsa-mir-1262 in TRS and its potential implications for personalized medicine in psychiatric disorders.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGGGUGAAUUUGUAGAAGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes (chimpanzee) ptr-miR-1262
  2. Pongo pygmaeus ppy-miR-1262
Publications