Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 20 (SNORA20) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 20 (SNORA20) URS00005682D3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA20: SNORA20 is a small nucleolar RNA (snoRNA) [PMC8742282]. It is one of the 12 snoRNAs identified in a study, which included 10 SNORDs (SNORD6, SNOTRD116-23, SNORD116-25, SNORD116-29, SNORD18A, SNORD42A, SNORD43, SNORD58C, SNORD60, and SNORD 101) and 2 SNORAs (SNORA3B and SNORA20) [PMC8742282]. In another study focusing on differential DNA methylation regions (DMRs), a single DMR was observed for the F2RL3 gene as well as for the Small Nucleolar RNA H/ACA Box 20 (SNORA20) gene [PMC8917214]. Furthermore, in a study on gene expression changes in schizophrenia patients compared to healthy controls, it was found that among the top 10 differentially expressed genes (DEGs), five of them were non-coding genes including SNORA20 [PMC6439315]. In another study on keloids, multiple novel differential snoRNAs were identified including SNORA20 [PMC9045488]. Additionally, it was observed that expression of another snoRNA located within an intron of the TCP1 gene called SNORA20 is highly conserved across species [PMC4824147]. Furthermore, in an analysis of differentially expressed genes in hepatocellular carcinoma tissues compared to normal tissues it was found that the expression of several snoRNAs including reduced expression of both small nucleolar RNA 10 (SNOR10) and small nucleolar RNA H/ACA Box 14D (SNOR14D), as well as significantly reduced expression of small nucleolar RNA H/ACA Box 23 (SNOR23), and significantly reduced expression of small nucleolar RNA H/ACA Box 20 (SNORA20) [PMC7093170].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUCCCAUUUAUUUGCUGCUUGUAGUCUCACAGUGAUACGAGCAGUUAUACGCAUGGGAUAAAAUAACAUUGGGCCACUGUAAAUUGAGAUGAAGUAACCAUUUUCAUCUCUUCUGCAGGGACUAGACAUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications