Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-484 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-484 precursor URS00005651EE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-484: Hsa-mir-484 is a microRNA that is stably expressed in plasma and was chosen among other miRNAs for analysis using the BestKeeper software due to its limited intra-group variability expression [PMC8533962]. In a cohort study, hsa-mir-484 was found to be significantly different between multiple sclerosis (MS) patients and healthy subjects [PMC10062329]. Furthermore, the functional validation of hsa-mir-484 was demonstrated through an in vitro model that depicted the heterozygous deletion of MIR484, confirming its effect on miRNA expression and dysregulation of target genes [PMC9587983]. In silico analysis revealed that hsa-mir-484 is a predicted target of miR-1307, along with other miRNAs such as hsa-miR-193b-3p and hsa-miR-222-3p [PMC9578367].

MIR484: MIR484 is a microRNA that has been implicated in various biological processes and diseases. It has been found that certain target genes of MIR484 show dysregulation in cells with MIR484 heterozygous deletion, suggesting its potential role as a genetic driver in unresolved rare CNVs in CAKUT [PMC9587983]. In embryonic and postnatal cortex, MIR484 is expressed along with other genes such as Minp, Marf1, Fopnl, and Nde1 [PMC5322274]. Interestingly, MIR484 has been shown to suppress the translation of the mitochondrial fission protein FIS1 and inhibit FIS1-mediated fission and apoptosis in cardiomyocytes and adrenocortical cancer cells [PMC5764268]. In terms of prognosis, downregulated miRNAs including MIR484 have been associated with better prognosis [PMC6830093]. Furthermore, circulating miRNAs such as miR-100, miR-151a-5p, miRNA205, MIR484, miR23a or miR-135b have been proposed as potential tools for endometrial cancer diagnosis and monitoring [PMC8946652]. Additionally, MIR484 has been used as an internal reference for adjusting the relative sample microRNA expression using the equation 2−∆∆Ct [PMC6129855]. Lastly, a previous study identified LINC00339 as a target of MIR484 through bioinformatics and luciferase reporter analyses [PMC9445363]. Overall, these findings highlight the diverse roles of MIR484 in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCCUCGUCAGGCUCAGUCCCCUCCCGAUAAACCCCUAAAUAGGGACUUUCCCGGGGGGUGACCCUGGCUUUUUUGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications