Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4422 URS00005606AA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4422: Hsa-mir-4422 is a microRNA that has been identified in several studies [PMC9536303]. It has been found in up to five cancer modules, along with other microRNAs, due to mutual exclusivity [PMC9536303]. In a study on exosomes, hsa-mir-4422 was found to be upregulated only in the UVA group, along with other microRNAs [PMC7719707]. The relative expression of hsa-mir-4422 was analyzed using the 2–ΔΔCt method [PMC7719707]. Hsa-mir-4422 has also been identified as one of the miRNAs that regulate ESR1 and may serve as a potential biomarker for PCOS [PMC7901211]. In another study, hsa-mir-4422 was found to be involved in multiple pathways along with other miRNAs [PMC7052922]. The expression of hsa-mir-4422 was significantly different in the IM group compared to the NC group [PMC7052922].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGCAUCAGGAAGUACCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications