Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1292-5p URS00005586D0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1292: Hsa-mir-1292 is a microRNA that has been found to target lnc-AL355149.1-1, lnc-ZNF674-1, and hsa-mir-3613 [PMC4009106]. It has been shown to be highly expressed in individuals, with a log2 intensity of 7.5 [PMC3117799]. Hsa-mir-1292 is significantly upregulated in females and has a 1.63 to 1.94 fold-change in intensity levels [PMC3117799]. It is one of the miRNAs that are related to cancer prognosis or diagnosis, specifically for stomach adenocarcinoma (STAD) [PMC6856753]. Hsa-mir-1292, along with other miRNAs such as hsa-mir-509-2 and hsa-mir-2115, may serve as potential diagnostic biomarkers for STAD [PMC6856753]. In addition, hsa-mir-1292 has been found to be dysregulated between STAD tumor and paracancerous tissues [PMC6856753]. It is one of the miRNAs that are differentially expressed in SW480/STAT3-siRNA cells compared to SW480/siRNA-control cells [PMC4121995]. Hsa-mir-1292 has also been found to have aberrant methylation on the CGI shores of its promoter region [PMC4350105]. References: [PMC4009106] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4009106/ [PMC3117799] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3117799/ [PMC6856753] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6856753/ [PMC4121995] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4121995/ [PMC4350105] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4350105/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGAACGGGUUCCGGCAGACGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-1292
Publications