Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-937-3p URS0000553F51_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-937: Hsa-mir-937 is a microRNA that has been identified as a potential regulator of COL1A2, LEP, and SERPINE1, and further investigation is needed to confirm this [PMC7646902]. The expression levels of hsa-mir-937, hsa-miR-148b*, hsa-miR-3907, and hsa-miR-367* were validated using RT-qPCR and were found to be significantly decreased in patients with EOPE compared to the control group [PMC7646902]. Additionally, the expression levels of COL1A2, LEP, and SERPINE1 were significantly increased in the EOPE group [PMC7646902]. The expression changes of hsa-mir-937, hsa-miR-148b*, hsa-miR-3907, hsa-miR-367*, COL1A2, LEP, and SERPINE1 were also validated in the placenta of patients with PE compared to controls [PMC7646902]. Specific primers for amplifying hsa-mir-937 were listed in Table III [PMC7646902]. Furthermore, miR-937 was found to be significantly downregulated in patients with chronic obstructive pulmonary disease (COPD) compared to healthy controls [PMC8231861]. In cervical squamous cell carcinoma (CESC), miR-937 was identified as one of the miRNAs associated with poor overall survival [PMC7333649]. The prognostic value of miRNAs including miR-937 was evaluated using the Kaplan-Meier Plotter database [PMC7333649]. In a study on asthma patients exposed to diesel exhaust particles (DEP), miRNA profiling revealed altered blood expression levels of several miRNAs including miR-937 [PMC4786978]. Additionally, in autism spectrum disorder (ASD), miR-937 was found to be downregulated [PMC9000903].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCCGCGCUCUGACUCUCUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-937
Publications