Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1283 URS0000552112_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-1283: Hsa-mir-1283 is a microRNA molecule that has been identified in various studies and datasets. It is a member of the miR-1283 family and has been found to be associated with essential hypertension [PMC6746216]. It has also been shown to potentially regulate the expression of ATF1, a gene that is abnormally expressed in essential hypertension [PMC6746216]. Additionally, hsa-mir-1283 has been predicted to target the 5ʹUTR of the SARS-CoV-2 genome, suggesting its potential role in viral infection [PMC8527307]. Furthermore, hsa-mir-1283 has been linked to onco-protective roles and inhibition of apoptosis, indicating its potential involvement in cancer development [PMC9459146]. The ATF1 rs11169571 variant has been shown to alter the binding site of hsa-mir-1283 and increase susceptibility to colorectal cancer [PMC9688512]. The hsa-mir-1283 cluster, which includes several miRNAs such as hsa-miR-320a and hsa-miR-374a, is characterized by a high enrichment in flanking Alu sequences and may have co-evolved with the miR cluster [PMC3926826]. Hsa-mir-1283 expression has also been found to be significantly different between pregnant and non-pregnant women [PMC8759232]. In various datasets related to different conditions such as cardiovascular disease and colorectal cancer, differential expression of hsa-mir-1283 has been observed [PMC8923688] [PMC7453507] [PMC4159370] [PMC9814319].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUACAAAGGAAAGCGCUUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-1283a
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-1283a
Publications