Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) GRHL3 antisense RNA 1 URS000055188E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GRHL3-AS1: GRHL3-AS1 is a long non-coding RNA (lncRNA) that has been studied in relation to various diseases, including primary head and neck squamous cell carcinoma (HNSC) [PMC8220827]. In a study, a risk score formula was developed, and GRHL3-AS1 was one of the four important m6A-modified lncRNAs identified [PMC8220827]. The expression of GRHL3-AS1 was found to be upregulated in patients with primary HNSC, and its expression level was associated with patient survival [PMC9354258]. Additionally, GRHL3-AS1 was identified as one of the eight lncRNAs associated with prognosis in HNSC patients [PMC9354258]. In another study, GRHL3-AS1 was reported to have a prognostic function in primary head and neck squamous cell carcinoma [PMC9462982]. Furthermore, the Sankey diagram analysis revealed that GRHL3-AS1 is a risk factor for HNSC [PMC10054813]. Overall, these findings suggest that GRHL3-AS1 plays a significant role in the development and prognosis of primary head and neck squamous cell carcinoma.

Targeting miRNAs 3 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCGGGGCUGCCCAGGGCUGCGGGCUCCAGGCACCCAGAGCGCUGCGACCACAUGAAAGGCCCGGCGCUCAGCACCCGCCAGCCACCUCCAGCUGGUUUCUAACUACACCGCCGGGGCCUCCAUGCUUCUCAGAGACCAGCCUUCGAAGUGCCGCCUUACACCCGGGGCCUGGCCACCGGGCGGGCGCGGAUGGAGCUCUGGUCCACAUUUGGGAGCUCACAGUUGUUCCUGCCAGGAACCAGCCAGAACAGGAGGCAGCCAGGGAGAGGGGAGCCAGGGAGAACACAGCCUCAGUCCUGGAAGGAGAGGGCCUGCUGGGAAGAACAGAACCCAGCUGUCUUGGCCCCAGAUGUGGAAGCUGAGACUUAAAGAAGCUAUGAAACUUGAUCAGGUCAUGCAGCGCCAGAGGACCCAAGGUGGGAUCUCAACCCAGACUGUUUGGCUCCAAAGCUGAACUGCUACAUUACGUUGCUUCAGCAAACAGUCAUUCAGAGACAAUGGGCUUUAGAGGAGUUUAGUGAUGUUACUAACAAACAUAAGUACCUUGUACUAACCUCCUGGUGCCCAAGUGUUUGAGGUGAGAAAAACUGAAACAUGAAAAGCCCAGAGAGGUAAAGUGACUGGCUCAAGCAAAUACAGGCUCCAGCUGCAGCCACUUUGAAGAUAAAGUUUCCUCCAUAGAAAUUCUGCAAUACAGAUGUCCUUCCGCGGUCCCAGUUCAGUCCUGCACCAGUUCCUUUUCCCACUGGGAAAUUUCUUUCCUCUUCCUACUUCCAUGCAACUGCGAGGCAAGGCUCAAGCCCACUUCCUUCUCCUUUUCCUGUGCCUCCCUGUGGAGGGAGCUCCCUCUUCUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications