Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-667-3p URS000054D3E6_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-667: Mmu-mir-667 is a mature miRNA derived from the mmu-mir-667 precursor miRNA, which is relatively unique in the mouse genome/transcriptome [PMC6366741]. It is one of the miRNAs located on chromosome 12, specifically in a clustered region with mmu-mir-679 [PMC6366741]. Mmu-mir-667 is the only candidate in this region whose targets are predicted to have a significant association with P < 0.001 [PMC4579042]. It does not have targets in Comt mRNA, which is downregulated by other miRNAs such as mmu-miR-3470a/b [PMC4579042]. Lentiviral injections of mmu-miR-3470a, mmu-miR-3470b, and mmu-mir-667 have been shown to increase hypersensitivity during tonic inflammatory pain states in mice [PMC4579042]. The expression of mmu-mir-667 and other related miRNAs has been estimated across various mouse tissues and cells using RNA-seq data sets [PMC4579042]. Lentiviral vectors were used to subcutaneously inject these miRNAs into the foot plantar surface to confirm their modulation of pain responses in vivo [PMC4579042]. In vitro experiments have shown that both mRNA and enzymatic activity of murine ancestral Comt can be downregulated by mmu-mir-667, mmu-miR-3470a, or mmu-miR-3470b miRNAs. Mmu-mir-667 has been found to downregulate COMT protein level more robustly than mRNA level, suggesting its role in controlling translational efficiency as well as mRNA stability [PMC4579042].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGACACCUGCCACCCAGCCCAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications