Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-140 precursor URS00005471BA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR140: MIR140 is a type of microRNA that has been studied in relation to various physiological processes, including embryogenesis mediated by epigenetic modifications [PMC7890887]. In SED MIR140 type Nishimura, epiphyseal maturation is delayed, while in acrodysostosis, particularly carpal ossification, is advanced [PMC6622181]. These findings suggest that MIR140 plays a role in skeletal development and maturation [PMC6622181]. Additionally, miR29 has also been implicated in embryogenesis mediated by epigenetic modifications [PMC7890887]. These microRNAs may be involved in regulating gene expression and influencing the development of various tissues and organs during embryogenesis [PMC7890887]. Further research is needed to fully understand the specific mechanisms by which MIR140 and miR29 contribute to these processes. However, these studies highlight the importance of microRNAs in embryonic development and suggest their potential as therapeutic targets for developmental disorders.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGUCUCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGGAUACCGGGGCACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

Publications