Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 20 (SNORD20) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 20 (SNORD20) URS000053D4AB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD20: SNORD20 is a small nucleolar RNA (snoRNA) that is significantly upregulated in gallbladder cancer (GBC) tissue [PMC5386738]. It is also among the top upregulated differentially expressed genes (CDEGs) in GBC tissue [PMC8319719]. SNORD20 is expressed in glioblastoma cell lines and occupies the eighth place among the most expressed RNAs [PMC7461500]. It shows a peak of CLIP reads at the D box [PMC4053766]. SNORD20 is also found to be enriched in snoRNA-derived small nucleolar RNA fragments (snoRFs) [PMC9624364]. In addition to GBC, SNORD20 has been identified in lung tissues of patients with pulmonary arterial hypertension (PAH) and primary acute myeloid leukemia (AML1-ETO+) samples with high leukemia stem cell content [PMC8346036] [PMC8629011]. SNORD20 represents over 40% of the total snoRNAs found in EV-enriched sweat, and its main role is the modification of rRNA through 2'-O-methylation [PMC8188706]. It has been overexpressed in HeLa cells to study its role, along with other control snoRNAs that are not associated with mRNA 3' processing complex [PMC5587809]. Defects in the nucleolin gene, which gives rise to SNORD20, have been linked to C9ORF72 repeat-related amyotrophic lateral sclerosis (ALS)100 [PMC5884852]. Overall, SNORD20 plays a role in various cancer types and has implications for RNA modification and disease pathology.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAUAUGAUGACUGAUUACCUGAGAAAUAAUUGAUGAAAUCUCAAGAAAAUUCCUCUAGAUAGUCAAGUUCUGAUCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

2D structure Publications