Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3132 URS000053C4D7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3132: Hsa-mir-3132 is a mature miRNA that has been identified as a potential epigenetic factor of NAT2 [PMC8651391]. In a study comparing T2DM patients with and without CLI, hsa-mir-3132 was found to be significantly upregulated in patients with CLI [PMC6261237]. Additionally, hsa-mir-3132 has been found to be overmutated in CHOL cancer [PMC7648123]. It is part of a cluster of miRNAs that are expressed at a moderate level [PMC9016216]. In a case-control study, hsa-mir-3132 was identified as one of the differentially expressed miRNAs in the blood of colorectal cancer patients who developed VTE [PMC9361765]. Hsa-mir-3132 has also been found to target ORF-3a and is potentially involved in the regulation of ORF-6 [PMC9160520]. Overall, hsa-mir-3132 has been implicated in various biological processes and diseases, highlighting its potential importance as a regulatory molecule.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGUAGAGAAGGAGCUCAGAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications