Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FARSA antisense RNA 1 (FARSA-AS1) URS000053A37E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FARSA-AS1: FARSA-AS1 is a long non-coding RNA (lncRNA) that is regulated by the transcription factor SOX9 [PMC7736271]. Silencing SOX9 leads to a decrease in the expression of FARSA-AS1, while overexpression of SOX9 results in an increase in FARSA-AS1 expression [PMC7736271]. This regulation of FARSA-AS1 by SOX9 is demonstrated in cells, where the upregulation of FARSA-AS1 is observed [PMC7736271]. FARSA-AS1 is an lncRNA that has been implicated in various biological processes and diseases [PMC7736271]. It has been shown to play a role in cancer progression and metastasis, as well as in the regulation of cell proliferation and apoptosis [PMC7736271]. The specific mechanism by which FARSA-AS1 functions and its downstream targets are still being investigated. However, its regulation by SOX9 suggests that it may be involved in processes regulated by this transcription factor. Understanding the role of lncRNAs like FARSA-AS1 and their interactions with transcription factors such as SOX9 can provide valuable insights into gene regulation and cellular processes [PMC7736271]. Further research into the functions and mechanisms of action of lncRNAs like FARSA-AS1 will contribute to our understanding of gene expression regulation and may have implications for therapeutic interventions targeting these molecules [PMC7736271].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUCGCUGGAAAAGAGAGGCUGCAGUGAUGUGGAUAGCACACUCAUCUGACCGGCUCUAGCUCCUGCUAUCGCUUCCCAGUUCCCUCAUGAGAGAACAGACUCAGCCGUCACCUGCACCAGGCCGCUCUCCCUGACCCCCAAGGCUGGGUCAGCUGUCACAGCUGGGUCCCCUGUUUUCCCCCAUCACUCUGGUUCUUGAAGCACCUUCCUAUUACGUCGCAACCUGCGUGAGGGCAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes (chimpanzee) antisense RNA
Publications