Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-351-5p URS0000537D7C_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-351: Mmu-mir-351, along with other microRNAs such as mmu-mir-30c, mmu-miR-26a, and mmu-mir-25, has been extensively studied and reported to be expressed during superovulation [PMC4499447]. It has also been validated as one of the microRNAs expressed during alcohol treatment, with its expression being up-regulated [PMC6206094]. Mmu-mir-351 is part of a genomic cluster on the mouse X-chromosome that includes other microRNAs such as mmu-miR-503 and mmu-miR-542-5p [PMC3477035]. It has been found to be expressed in retinal neurons, including photoreceptors [PMC5032015]. Its expression has been shown to be up-regulated in different contexts such as P17 OIR retinas and liver egg deposition [PMC5032015][PMC9861972]. Mmu-mir-351 has also been implicated in the regulation of gene expression during meiotic initiation and progression [PMC3599307]. It has predicted target genes such as Coasy and Mlycd [PMC3692539]. Additionally, it is conserved in both mouse (mmu) and rat (rno) species [PMC3248702].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGAGGAGCCCUUUGAGCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications