Homo sapiens (human) small nucleolar RNA, C/D box 16 (SNORD16)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 16 (SNORD16) URS0000535D45_9606

100 nucleotides
6 databases (ENA, GeneCards, HGNC, IntAct, MalaCards, RefSeq)
Found in 0 other species
190 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD16: SNORD16 is a small nucleolar RNA (snoRNA) that is found to be overexpressed in cervical cancer (CC) tissues [PMC7359415]. This overexpression of SNORD16 is associated with a worse prognosis for patients with CC [PMC7359415]. Additionally, it has been observed that SNORD16 is required for the generation of a protected fragment in a reaction containing regRNP17 and 18S [PMC5612246].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGCAAUGAUGUCGUAAUUUGCGUCUUACUCUGUUCUCAGCGACAGUUGCCUGCUGUCAGUAAGCUGGUACAGAAGGUUGACGAAAAUUCUUACUGAGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure

Publications