Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 68 (SNORA68) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 68 (SNORA68) URS00005357F7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA68: SNORA68 is a small nucleolar RNA (snoRNA) that has been studied in various diseases, including cancer and schizophrenia [PMC6439315]. Several studies have developed risk assessment models based on snoRNA expression, including SNORA68, to predict overall survival in cancer patients [46–48]. Gao et al. developed a risk formula that identified SNORA68 in non-small cell lung cancer patients and validated it in a testing set [46]. Similarly, Zhao et al. established a risk assessment model using SNORA68 and other snoRNAs in clear cell renal cell carcinoma [35]. However, many risk assessment models based on snoRNA expression have not been validated in clinical cases [PMC9005336]. In non-small cell lung cancer tissues, SNORA68 has been found to be upregulated compared to adjacent normal tissues [PMC8017274]. In ovarian cancer patients, high expression of both SNORA68 and another snoRNA called SNORD74 is associated with poor prognosis [PMC7862201]. These two snoRNAs can predict poor overall survival specifically in serous adenocarcinoma of the ovaries [PMC7862201]. Additionally, the combination of SNORA68 and SNORD74 can predict clinicopathological features associated with poor prognosis in ovarian cancer patients [PMC7862201]. Overall, the studies suggest that SNORA68 is involved in disease pathogenesis and can be used as a prognostic marker for various cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUGCACCUAAACCCAAGAAUCACUGUUUCUUAUAGCGGUGGUUUAAACAGAGGUGCAAACAGCAAGCGGAUCUUGUCGCCUUUGGGGGGCUGUGGCCGUGCCCCUCAAAGUGAAUUUGGAGGUUCCACAACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications