Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 60 (SNORD60) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 60 (SNORD60) URS000053336F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD60: SNORD60 is a small nucleolar RNA (snoRNA) that has been found to play a role in intracellular cholesterol trafficking, independent of its predicted function of methylating ribosomal RNAs [PMC6710452]. Knockdown of other snoRNAs, such as Rpl13a snoRNAs U32a, U33, U34, and U35a, has been shown to increase glucose-mediated insulin secretion and systemic glucose tolerance in mice [PMC6710452]. In a study involving miRNA analysis, equal volumes of reverse transcription (RT) primers for each miRNA and random hexamer primers for the reference gene SNORD60 were pooled and added to the RT reaction of each sample [PMC8876825]. These findings suggest that SNORD60 may have a role in cholesterol trafficking within cells and may have implications for glucose-mediated insulin secretion and glucose tolerance. Further research is needed to fully understand the mechanisms by which SNORD60 functions in these processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUCUGUGAUGAAUUGCUUUGACUUCUGACACCUCGUAUGAAAACUGCACGUGCAGUCUGAUUAUUUAGCAAGACUGAGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Gorilla gorilla gorilla Small nucleolar RNA SNORD60
  2. Pan troglodytes Small nucleolar RNA SNORD60
2D structure Publications