Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 24 (SNORD24) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 24 (SNORD24) URS000052FCE0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD24: SNORD24 is a small nucleolar RNA (snoRNA) belonging to the C/D box class [PMC3994072]. It has been used as an endogenous control in various studies [PMC3994072] [PMC5027482] [PMC9219770] [PMC9413531] [PMC6778116]. SNORD24 has been identified in the CCEF00389 genome assembly and is classified as an Rfam class snoRNA [PMC5040776]. It has been found to be differentially expressed in B-cell precursor acute lymphoblastic leukemia (BCP-ALL) and T-cell acute lymphoblastic leukemia (T-ALL) [PMC9219770]. SNORD24 is part of an expression pattern that includes other box C/D snoRNAs and scaRNAs in BCP-ALL and T-ALL [PMC9413531]. It has also been found to be overexpressed in Hodgkin's lymphoma cases compared to non-Hodgkin's lymphoma cases [PMC9413531]. SNORD24 has been used as a reference RNA for semen identification, although its suitability for this purpose has been questioned [PMC6778116]. Additionally, SNORD24 forms duplexes with mismatches when binding to 28S rRNA in chickens, along with other snoRNAs such as SNORD12/SNORD106, SNORD50, SNORA17 (GGN58), and SNORA63 [PMC7812872]. In humans, SNORD24 is an ortholog of the C/D box snoRNA U24 found within the RPL7A gene intron 2. It exhibits different levels of conservation with sponge orthologs compared to humans. Furthermore, it has been found to be overexpressed in colon cancer cell lines compared to normal colon cell lines. However, its expression stability varies between tissues and cells. SNORD24 has also been included in signature panels specific to certain subgroups of multiple myeloma patients [PMC5209713] [PMC8629011].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAGAUGAUGUAAAAGAAUAUUUGCUAUCUGAGAGAUGGUGAUGACAUUUUAAACCACCAAGAUCGCUGAUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications