Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-145-5p URS0000527F89_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-145: Hsa-mir-145 is a microRNA that has been studied in various contexts. In a study, total RNA samples were analyzed using RT-qPCR to measure the expression of hsa-mir-145, along with other markers such as hsa-miR-1228, hsa-miR-451, and hsa-miR-222 [PMC5700540]. The study also identified potential regulation areas for hsa-mir-145, including a Gy-Box and putative miRNA binding sites [PMC3519812]. Another study found that low expression of hsa-mir-145 was associated with poorer overall survival in patients [PMC5702163]. In the context of stomach adenocarcinoma, hsa-mir-145 and hsa-mir-133a-1 were considered as potential prognostic indicators [PMC9633210]. Additionally, in cancer tissues, hsa-mir-145 was found to be downregulated along with other miRNAs such as hsa-miR-16 and hsa-miR-143 [PMC3835097]. These findings suggest that the expression of hsa-mir-145 may have implications for prognosis and cancer development.

mRNA interactions 23 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCCAGUUUUCCCAGGAAUCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 47 other species

  1. Alligator mississippiensis Ami-Mir-145_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-145_5p (mature (guide))
  3. Bos taurus bta-miR-145
  4. Callithrix jacchus cja-miR-145
  5. Callorhinchus milii Cmi-Mir-145_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-145
  7. Capra hircus (goat) chi-miR-145-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-145-5p
  9. Cervus elaphus (red deer) cel-miR-145
  10. Chrysemys picta bellii Cpi-Mir-145_5p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-145-5p
  12. Columba livia cli-miR-145-5p
  13. Danio rerio Dre-Mir-145_5p (mature (guide))
  14. Daubentonia madagascariensis dma-miR-145
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-145_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-145
  17. Gadus morhua gmo-miR-145-5p
  18. Gallus gallus (chicken) Gga-Mir-145_5p (mature (guide))
  19. Gekko japonicus Gja-Mir-145_5p (mature (guide))
  20. Ictalurus punctatus ipu-miR-145
  21. Latimeria chalumnae Lch-Mir-145_5p (mature (guide))
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-145_5p (mature (guide))
  23. Macaca mulatta Mml-Mir-145_5p (mature (guide))
  24. Microcaecilia unicolor Mun-Mir-145_5p (mature (guide))
  25. Microcebus murinus (gray mouse lemur) mmr-miR-145
  26. Monodelphis domestica mdo-miR-145-5p
  27. Monopterus albus Mal-Mir-145_5p (mature (guide))
  28. Mus musculus (house mouse) mmu-miR-145a-5p
  29. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-145
  30. Oreochromis niloticus oni-miR-145
  31. Ornithorhynchus anatinus Oan-Mir-145_5p (mature (guide))
  32. Oryctolagus cuniculus ocu-miR-145-5p
  33. Otolemur garnettii (small-eared galago) oga-miR-145
  34. Pan paniscus (pygmy chimpanzee) ppa-miR-145
  35. Papio hamadryas (hamadryas baboon) pha-miR-145
  36. Petromyzon marinus pma-miR-145-5p
  37. Pteropus alecto pal-miR-145-5p
  38. Python bivittatus (Burmese python) pbv-miR-145-5p
  39. Rattus norvegicus (Norway rat) rno-miR-145-5p
  40. Salmo salar (Atlantic salmon) ssa-miR-145-5p
  41. Sarcophilus harrisii Sha-Mir-145_5p (mature (guide))
  42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-145_5p (mature (guide))
  43. Sphenodon punctatus (tuatara) Spt-Mir-145_5p (mature (guide))
  44. Taeniopygia guttata Tgu-Mir-145_5p (mature (guide))
  45. Tursiops truncatus (common bottlenose dolphin) miR-145a-5p
  46. Xenopus laevis (African clawed frog) Xla-Mir-145-P2_5p (mature (guide))
  47. Xenopus tropicalis Xtr-Mir-145_5p (mature (guide))
Publications