Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1538 URS00005235AA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1538: Hsa-mir-1538 is a microRNA (miRNA) that has been identified in various studies. It has been found to interact with different genes and play a role in various biological processes. For example, in a study analyzing the topological properties of genes, hsa-mir-1538 was found to be connected to the gene ZNF704 [PMC8725226]. In another study focused on Influenza A H1N1 virus, specific binding positions of hsa-mir-1538 were found to be conserved among different virus sequences [PMC3521223]. Additionally, hsa-mir-1538 was identified as one of the dysregulated miRNAs involved in bacterial pathways connected to Alzheimer's disease and Parkinson's disease [PMC9468484]. It was also identified as one of the hub miRNAs in a study investigating the interaction between different types of RNA molecules [PMC8176956]. Furthermore, hsa-mir-1538 was found to be differentially expressed during headache attacks compared to interictal samples [PMC9438144]. Lastly, hsa-mir-1538 was mentioned as a miRNA with potential for future investigations in another study [PMC6411762]. These findings highlight the importance of hsa-mir-1538 and its potential role in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGCCCGGGCUGCUGCUGUUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications