Homo sapiens (human) small Cajal body-specific RNA 15 (SCARNA15)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small Cajal body-specific RNA 15 (SCARNA15) URS00005172B7_9606

127 nucleotides
8 databases (ENA, Ensembl, GeneCards, HGNC, RefSeq, Rfam, snoDB, snOPY)
Found in 5 other species
81 publications
1. sncRNA
2. snoRNA
3. scaRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA15: SCARNA15 is a small nucleolar Cajal body specific RNA gene that is upregulated in the nM state [PMC6277527]. To investigate the specific contribution of distinct oncogenes towards SCARNA15 regulation, a comparison was made between melanoma (MM383) and lung adenocarcinoma (A549) cells carrying BRAF and KRAS mutations, respectively, and lymphoma (Daudi) to breast (MDA-MB-436) cancer cells characterized by MYC gene alterations [PMC8271217]. In the nM state, DICER and small nucleolar Cajal body specific RNA genes (SNORD16, SNORNA81, SCARNA15) were found to be upregulated [PMC6277527]. To target SCARNA15 in cells, lentiviruses expressing a small guide RNA targeting SCARNA15, spCas9 and eGFP were transduced [PMC8271217].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CUGGAGACUAAGAAAAUAGAGUCCUUGAAAUCAAGCUGACUCUGCUUUUAGCCUCCUAAAUGAAAAGGUAGAUAGAACAGGUCUUGUUUGCAAAAUAAAUUCAAGACCUACUUAUCUACCAACAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.