Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 82 (SNORD82) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 82 (SNORD82) URS00005160A3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD82: SNORD82 is a small nucleolar RNA (snoRNA) that has been identified in various studies. It is one of several snoRNAs that have been found to be expressed in different tissues and associated with different outcomes. In one study, the expression pattern of SNORD82 was found to be associated with four other snoRNAs (SNORD24, SNORD44, SNORD105) and two small Cajal body-specific RNAs (scaRNA6 and scaRNA9) [PMC9413531]. Another study found that SNORD82 was upregulated in benign breast tissue compared to invasive lobular breast cancer (ilBC), and in ilBC compared to metastasized breast cancer, suggesting it could be indicative of a less aggressive phenotype [PMC9803687]. The association between SNORD82 and metastasis has not been previously reported, but it has been suggested as a prognostic marker for breast cancer [PMC9803687]. Additionally, SNORD82 was found to be significantly elevated upon HCV infection [PMC5493846]. In the context of hepatocellular carcinoma (HCC), SNORD82 was among the downregulated probes compared to HCCN (non-tumor tissue) [PMC5601746]. Overall, these studies highlight the potential clinical relevance and prognostic potential of SNORD82 in various cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGCACAAAUGAUGAAUAACAAAGGGACUUAAUACUGAAACCAGAUGUUACAUUGUAGUGUGCUGAUGUGCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications