Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FOXC2 antisense RNA 1 (FOXC2-AS1) URS000050E6E3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FOXC2-AS1: FOXC2-AS1 is a long non-coding RNA (lncRNA) that is located in close genomic proximity to the FOXC2 gene [PMC7658007]. FOXC2 has been shown to induce adipocyte mitochondriogenesis [57] and activate the signal transducer and activator of transcription 3-PRDM16 signal [58]. This proximity and functional effect led researchers to investigate the regulatory relationship between FOXC2-AS1 and FOXC2 [PMC7658007]. In a subsequent study, the role of FOXC2-AS1 in regulating phenotypic transition, proliferation, and migration of human great saphenous vein smooth muscle cells (SV-SMCs) was explored [PMC6894326]. It was found that FOXC2-AS1 is involved in upregulating FOXC2 through the formation of a stable RNA duplex [PMC8381522]. This upregulation also leads to an increase in ABCB1 expression in DOX-resistant osteosarcoma cells [PMC8381522]. These findings suggest that FOXC2-AS1 plays a role in regulating various cellular processes, including adipocyte mitochondriogenesis, phenotypic transition, proliferation, migration, and drug resistance. Further research is needed to fully understand the mechanisms by which FOXC2-AS1 exerts its regulatory effects on these processes [PMC7658007] [57] [58] [PMC6894326] [PMC8381522].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUGCCGGGCUUCUUGUCGUCGCGGGGCACCUUGACGAAGCACUCGUUGAGCGAGAGGUUGUGGCGGAUGCUGUUCUGCCAGCCCUGCUUGUUCUCCCGGUAGAAGGGGAAGCGGUCCAUGAUGAACUGGUAGAUGCCGUUCAAGGUUUCCUUGCACCCUUCCUGGCUGUUCAUCGGCUGCGUAUUCGAUUCUCAGCAAAAGGAUGUUGAGACAACCCACCAGGCCUCUUCGCUUCGGCCUCUUCGCUUCGGGGAGGCGACUAGAAGGCAAUGGGGCGUGCCACUUAUUUCCAAUAAAAGAACAGAAGACGAAAAUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications