Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-941 URS000050E4BA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-miR-941: Hsa-mir-941 is a microRNA that has been identified in the target gene-miRNA regulatory network and target gene-TF regulatory network in Type 1 Diabetes (T1D) [PMC8028841]. The regulatory networks in T1D include various genes such as GRIN2B, EGFR, DKK1, GJA1, RGS4, TLN1, IGF2R, POLR2A, ARHGAP1, HIP1, EYA1, CCL19, PRL, PRKACA, GAB2 and others [PMC8028841]. Hsa-mir-941 is one of the microRNAs that are part of these networks [PMC8028841]. A putative binding site for hsa-mir-941 has been predicted by Target Scan Human in the region of SNP rs1801157 [PMC4372333]. The loss of this binding site is predicted in the SNP variant [PMC4372333]. In summary, hsa-mir-941 is a microRNA that is involved in the regulatory networks associated with T1D. It has been identified as part of the target gene-miRNA and target gene-TF networks. Additionally, a putative binding site for hsa-mir-941 has been predicted in the region of SNP rs1801157. The loss of this binding site is predicted in the SNP variant. These findings provide insights into the potential role of hsa-mir-941 and its genetic variants in T1D pathogenesis [PMC8028841] [PMC4372333].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACCCGGCUGUGUGCACAUGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications