Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-let-7c-5p URS000050DE77_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGUAGGUUGUAUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 64 other species

  1. Alligator mississippiensis ami-let-7c-5p
  2. Anolis carolinensis (green anole) aca-let-7c-5p
  3. Bos taurus bta-let-7c
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7c
  5. Canis lupus familiaris (dog) cfa-let-7c
  6. Capra hircus (goat) chi-let-7c-5p
  7. Cavia porcellus cpo-let-7c-5p
  8. Cervus elaphus (red deer) cel-let-7c
  9. Chrysemys picta bellii (western painted turtle) Cpi-Let-7-P1b_5p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-let-7c-5p
  11. Columba livia cli-let-7c-5p
  12. Danio rerio (zebrafish) dre-let-7c-5p
  13. Daphnia magna Dma-Let-7_5p (mature (guide))
  14. Daphnia pulex (common water flea) Dpu-Let-7_5p (mature (guide))
  15. Dasypus novemcinctus dno-let-7c-5p
  16. Daubentonia madagascariensis dma-let-7c
  17. Echinops telfairi Ete-Let-7-P1c_5p (mature (guide))
  18. Equus caballus eca-let-7c
  19. Gadus morhua gmo-let-7c-5p
  20. Gallus gallus gga-let-7c-5p
  21. Gekko japonicus Gja-Let-7-P1b_5p (mature (guide))
  22. Gorilla gorilla (western gorilla) microRNA let-7c
  23. Haplochromis burtoni abu-let-7c
  24. Hippoglossus hippoglossus hhi-let-7c
  25. Homo sapiens hsa-let-7c-5p
  26. Hyalella azteca let-7a-5p
  27. Ictalurus punctatus (channel catfish) ipu-let-7c
  28. Lagothrix lagotricha (brown woolly monkey) microRNA let-7c
  29. Latimeria chalumnae (coelacanth) Lch-Let-7-P1c_5p (mature (guide))
  30. Lepisosteus oculatus (spotted gar) Loc-Let-7-P1c_5p (mature (guide))
  31. Limulus polyphemus Lpo-Let-7-P16_5p (mature (guide))
  32. Macaca mulatta mml-let-7c-5p
  33. Macaca nemestrina (pig-tailed macaque) microRNA let-7c
  34. Maylandia zebra mze-let-7c
  35. Microcaecilia unicolor Mun-Let-7-P1c_5p (mature (guide))
  36. Microcebus murinus (gray mouse lemur) mmr-let-7c
  37. Monopterus albus (swamp eel) Mal-Let-7-P1c2_5p (mature (guide))
  38. Neolamprologus brichardi (lyretail cichlid) nbr-let-7c
  39. Nomascus leucogenys (northern white-cheeked gibbon) nle-let-7c
  40. Ophiophagus hannah oha-let-7c-5p
  41. Oreochromis niloticus oni-let-7c
  42. Ornithorhynchus anatinus (platypus) oan-let-7c-5p
  43. Oryctolagus cuniculus (rabbit) ocu-let-7c-5p
  44. Otolemur garnettii oga-let-7c
  45. Ovis aries (sheep) oar-let-7c
  46. Pan paniscus ppa-let-7c
  47. Pan troglodytes ptr-let-7c
  48. Papio hamadryas (hamadryas baboon) pha-let-7c
  49. Paralichthys olivaceus pol-let-7a-5p
  50. Pongo pygmaeus (Bornean orangutan) ppy-let-7c
  51. Pteropus alecto pal-let-7c-5p
  52. Pundamilia nyererei pny-let-7c
  53. Python bivittatus (Burmese python) pbv-let-7c-5p
  54. Rattus norvegicus (Norway rat) rno-let-7c-5p
  55. Saguinus labiatus microRNA let-7c
  56. Salmo salar (Atlantic salmon) ssa-let-7c-5p
  57. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P1c_5p (mature (guide))
  58. Sphenodon punctatus (tuatara) Spt-Let-7-P1b_5p (mature (guide))
  59. Sus scrofa (pig) ssc-let-7c
  60. Taeniopygia guttata (zebra finch) tgu-let-7c-5p
  61. Tor tambroides (Thai mahseer) let-7c-5p
  62. Triops cancriformis tcf-let-7-5p
  63. Xenopus laevis (African clawed frog) xla-let-7c-5p
  64. Xenopus tropicalis (tropical clawed frog) xtr-let-7c
Publications