v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MED8 antisense RNA 1 (MED8-AS1) URS000050AECF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MED8-AS1: MED8-AS1 is a long non-coding RNA (lncRNA) that has been studied in various cancer types, including hepatocellular carcinoma (HCC) and clear cell renal cell carcinoma (CC). In HCC, pyroptosis-related lncRNAs, including MED8-AS1, have been found to predict the response to immunotherapy [PMC9857215]. In CC, a prognostic signature based on 10 cancer-related lncRNAs (CRLs) was constructed, including MED8-AS1 [PMC9960235]. Additionally, MED8-AS1 was included in a risk score model based on m6A-related lncRNAs in HCC [PMC9310490]. The expression levels of MED8-AS1 have been found to be significantly higher in HCC tissues compared to normal tissues [PMC9263208]. Similarly, in HCC cells, the expression of MED8-AS1 was significantly upregulated [PMC9846072]. In a study on HCC prognosis, a five-lncRNA prognostic signature was constructed that included MED8-AS1 [PMC9846072]. The expression of MED8-AS1 was found to be higher in the high-risk group of HCC patients [PMC9846072]. Overall, these studies highlight the potential role of MED8-AS1 as a prognostic marker and its association with cancer progression and response to treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGAACAUUAAAAAAGUCAUCUUAAGCAAGGUGUCCAGGAGGAAAGAAGUGACAUGGGAGAAUAGUCUGUUCAUCCACUCCUAGAACAGAUAGCUAAACCUGUGUGACUCCCAUUUAACGUCACAGAUCUUCAUCUCGGUCUGGAGACAACACCAGAGGAAUGAUGACCUGGUUACGGAACAGCGGUGUUUUUUCAUGCUUCAAGACCUUGUUCAGAGUGUUCAGCUGUCCAGAAAGCAAGGCAAAGCUGUCCAGGACAGAUGGCCUGGUGGUGGUAACAAGGUACACCCUACACUCCCUCACUGAGACAUUUUCGACAGACCUAAUGCCAGGAGAUCAUUCUCUCAUGUGCACCUCUGUAGCACAUGCACUCCAGCUUCCUCCAUCCUAGCAUCUGUGAGCCUGGCUGUCUUGUCAGUCUCUGGGAAAUCUGCCUACUCAUGAAGACUUCUCUGAACACCAGUCCUGCUCUCCCCUUUCCCUCCCCCAACCAACGACUCCAGCUUUCCAUCUGCUCUCAUCAUUUUGUUUCAACCUUCUCCUUGCUGAAUUAAUAUGCAAUCAUCUAUCUCUGUGUCAAUAUUCCCGUGCCUCUUUCACAAGCUCAGUCAACCCAUUAACAUUUAUUGAGACUACCAGCUGCAAGAAACUAAGUGACAAAUGAAAAACAAAAACCACACAUGCUUCUAAGCACUGGACAAACAAAUUAAAAUGCUGGGGGUCUGCAAAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications