Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-335-3p URS00005092C2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-335: Hsa-mir-335-5p is a microRNA that has been found to play a role in cancer progression, specifically in colorectal cancer (CRC) and other types of cancer [PMC7960496]. Studies have shown that high levels of hsa-mir-335-5p are associated with poor prognosis and metastasis in gastric cancer patients [32]. Similarly, high expression of hsa-mir-335-5p has been observed in uterine sarcoma patients with tumor metastasis and relapse, suggesting its potential as a prognostic marker [33]. In the context of CRC, upregulation of miR-335-5p has been found to promote the invasive ability of CRC cells [PMC7960496]. Additionally, single nucleotide polymorphisms (SNPs) in hsa-mir-335 have been identified to result in loss and alteration in cleavage site [PMC3851333]. In a study measuring the expression levels of various microRNAs, including hsa-mir-335, it was found that RNU48 and cel-miR-39 were used as internal and external controls, respectively [PMC8870702].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUUUCAUUAUUGCUCCUGACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Capra hircus (goat) chi-miR-335-3p
  2. Cavia porcellus cpo-miR-335-3p
  3. Cervus elaphus (red deer) cel-miR-335-3p
  4. Dasypus novemcinctus dno-miR-335-3p
  5. Macaca mulatta mml-miR-335-3p
  6. Mus musculus (house mouse) mmu-miR-335-3p
  7. Oryctolagus cuniculus (rabbit) ocu-miR-335-3p
  8. Pteropus alecto pal-miR-335-3p
Publications