Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-373-3p URS0000508C13_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-373: Hsa-mir-373 is a microRNA that is closely associated with breast cancer invasion and metastasis [PMC3608627]. In a study, secondary targets of hsa-mir-373 were investigated, and it was found that hsa-mir-373 regulates various miRNAs that play a role in breast cancer [PMC10131518]. These miRNAs include hsa-miR-24, hsa-miR-21, hsa-miR-200s, and hsa-mir-373 itself [PMC10131518]. Additionally, SNPs located in various miRNAs were selected for analysis, including miRNAs that regulate breast cancer-associated genes such as RAS, PTEN, ATM, BRCA1/2 (hsa-mir-149, hsa-mir-196a-2, hsa-mir-30c-1, hsa-mir146a and has let7f2), miRNAs regulating breast cancer-associated receptors ER (estrogen receptor), PR (progesterone receptor), and HER2 (human epidermal growth factor receptor 2) (hsa mir27a , has mir125b1 , has mir1051 , has mir1052) [PMC3608627]. These findings suggest that hsa-mir-373 plays a crucial role in breast cancer progression by regulating other miRNAs involved in various aspects of the disease such as gene regulation and receptor expression [PMC10131518] [PMC3608627].

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGUGCUUCGAUUUUGGGGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Macaca mulatta mml-miR-373
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-373
Publications