Homo sapiens (human) small nucleolar RNA, C/D box 47 (SNORD47)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 47 (SNORD47) URS0000507EBE_9606

77 nucleotides
8 databases (ENA, GeneCards, HGNC, MalaCards, RefSeq, Rfam, snoDB, snOPY)
Found in 1 other species
333 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD47: SNORD47 is an intronic snoRNA (small nucleolar RNA) that has been studied in the context of antisense technology [PMC7038934]. The snoMEN vectors, which are a form of antisense technology, were designed based on observations made with SNORD47 [PMC7038934]. These vectors involve replacing the wild-type M-box of intronic SNORD88C or SNORD47 with artificial sequences that target specific RNA molecules [PMC7038934]. The relative quantification of miRNAs (microRNAs) was measured using RT-qPCR, with specific primers for let-7a and SNORD47 serving as an internal control [PMC6760475].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AACCAAUGAUGUAAUGAUUCUGCCAAAUGAAAUAUAAUGAUAUCACUGUAAAACCGUUCCAUUUUGAUUCUGAGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.