Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-20a precursor URS0000507C9B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR20A: MIR20A is a type of microRNA that is involved in mediating MYC and STAT3 dosage compensation through a redundant mechanism [PMC8627999]. In a study investigating regenerative therapy for jawbone atrophy, an atelocollagen-based gene-activated matrix (GAM) containing naked-pDNAs encoding MIR20A was used [PMC7955717]. The expression of MIR20A, along with other microRNAs, was assessed using RT-PCR and shown in Figure 4 [PMC9687337]. SNHG5, an upregulated gene, was found to reduce MIR20A expression and increase the expression of apoptosis proteins BECN1, ATG5, and ATG7 [PMC6912041]. Additionally, SNHG5 could interact with MIR32 to reduce the migration and proliferation effects of SNHG5 on gastric cancer cells [PMC6912041]. In a preliminary experiment using cultured MSCs, it was found that the delivery of MIR20A using an atelocollagen-based GAM had high transfection efficacy without cytotoxicity compared to commercial vectors such as a lentiviral vector [PMC7955717].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCAUUAUGAGCACUUAAAGUACUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Ailuropoda melanoleuca microRNA 20a (ENSAMEG00000023283.2)
  2. Aotus nancymaae (Ma's night monkey) microRNA 20a (ENSANAG00000015021.1)
  3. Ateles geoffroyi microRNA age-mir-20 precursor
  4. Bos taurus microRNA bta-mir-20a precursor
  5. Capra hircus (Goat) microRNA mir-20a (ENSCHIG00000009259.1)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA 20a (ENSCCAG00000003025.1)
  7. Cercocebus atys (Sooty mangabey) microRNA 20a (ENSCATG00000020027.1)
  8. Chlorocebus sabaeus (African green monkey) microRNA 20a (ENSCSAG00000025440.1)
  9. Choloepus hoffmanni miRNA (ENSCHOG00000014344.1)
  10. Colobus angolensis palliatus miRNA (ENSCANG00000009318.1)
  11. Equus caballus microRNA eca-mir-20a precursor
  12. Gorilla gorilla gorilla ggo-mir-20a (ENSGGOG00000032749.2)
  13. Gorilla gorilla microRNA ggo-mir-20a precursor
  14. Lagothrix lagotricha microRNA lla-mir-20 precursor
  15. Macaca mulatta (Rhesus monkey) microRNA mml-mir-20a precursor
  16. Macaca nemestrina microRNA mne-mir-20 precursor
  17. Mandrillus leucophaeus microRNA 20a (ENSMLEG00000015033.1)
  18. Marmota marmota marmota microRNA 20a (ENSMMMG00000021343.1)
  19. Mustela putorius furo microRNA 20a (ENSMPUG00000023481.1)
  20. Myotis lucifugus microRNA 20a (ENSMLUG00000017816.1)
  21. Neogale vison microRNA 20a (ENSNVIG00000016027.1)
  22. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 20a (ENSNLEG00000019456.2)
  23. Ovis aries miRNA (ENSOARG00000025155.1)
  24. Pan paniscus microRNA ppa-mir-20 precursor
  25. Panthera pardus microRNA 20a (ENSPPRG00000014295.1)
  26. Panthera tigris altaica microRNA 20a (ENSPTIG00000002079.1)
  27. Pan troglodytes microRNA ptr-mir-20a precursor
  28. Pongo abelii miRNA
  29. Pongo pygmaeus microRNA ppy-mir-20a precursor
  30. Pteropus vampyrus microRNA 20a (ENSPVAG00000024896.1)
  31. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 20a (ENSRBIG00000009738.1)
  32. Rhinopithecus roxellana microRNA 20a (ENSRROG00000003835.1)
  33. Saguinus labiatus microRNA sla-mir-20 precursor
  34. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 20a (ENSSBOG00000009772.1)
  35. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000003442.1)
  36. Sus scrofa microRNA ssc-mir-20a precursor
  37. Tupaia belangeri (northern tree shrew) microRNA 20a (ENSTBEG00000017955.1)
  38. Tursiops truncatus microRNA 20a (ENSTTRG00000022154.1)
  39. Urocitellus parryii microRNA 20a (ENSUPAG00010007917.1)
  40. Ursus americanus (American black bear) microRNA 20a (ENSUAMG00000023255.1)
  41. Ursus maritimus (Polar bear) microRNA 20a (ENSUMAG00000025288.1)
  42. Ursus thibetanus thibetanus microRNA 20a (ENSUTTG00000000117.1)
  43. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015012883.1)
Publications