Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-23a-5p URS00005070A9_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-23a: Mmu-mir-23a is a microRNA that has been extensively studied in various contexts [PMC4346489]. In a study by [PMC4346489], it was found that mmu-mir-23a was differentially expressed in both plasma and aorta tissue samples, with its expression being downregulated. This finding was consistent with the results obtained from microarray analysis [PMC4346489]. Furthermore, the study identified three pathways enriched with predicted targets of mmu-mir-23a that were differentially expressed in atherosclerotic tissue compared to control tissue [PMC4346489]. Another study [PMC3597329] investigated the expression of mmu-mir-23a in response to UVB irradiation and baicalin treatment. The results showed that mmu-mir-23a was highly expressed in the baicalin plus UVB treated group compared to the UVB group [PMC3597329]. In addition, mmu-mir-23a has been implicated in various biological processes and diseases, such as neuropathic pain [PMC8914318], asthma [PMC3030602], inflammation, and cancer [PMC4062425]. The role of mmu-mir-23a has also been investigated in the interaction between endothelial cells (ECs) and neural stem/progenitor cells (NSPCs) [PMC7758130]. Furthermore, it has been suggested that mmu-mir-23a is regulated by Smad members and may play a role in oligodendrocyte differentiation and myelin formation [PMC7906897]. Overall, these studies highlight the importance of mmu-mir-23a in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGUUCCUGGGGAUGGGAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Cavia porcellus (domestic guinea pig) cpo-miR-23a-5p
  2. Cervus elaphus cel-miR-23a-5p
  3. Cricetulus griseus cgr-miR-23a-5p
  4. Dasypus novemcinctus dno-miR-23a-5p
  5. Homo sapiens (human) hsa-miR-23a-5p
  6. Rattus norvegicus rno-miR-23a-5p
Publications