Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) APOA1 antisense RNA (APOA1-AS) URS00005069DC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

APOA1-AS: APOA1-AS is a long non-coding RNA (lncRNA) that has been identified as a potential biomarker for diagnosis and monitoring of coronary heart disease (CHD) [PMC8544698]. APOA1-AS is a member of the natural antisense transcript (NAT) class of lncRNAs, similar to APOA4-AS [PMC7689550]. APOA4, on the other hand, is involved in various physiological functions such as lipid absorption, metabolism, and platelet aggregation [PMC7689550]. The expression of APOA4-AS is elevated in fatty liver disease, and depletion of this lncRNA in the ob/ob mouse model leads to reduced expression of APOA4 and decreased serum triglyceride levels [PMC7689550]. These findings suggest that APOA1-AS and APOA4-AS may play important roles in lipid metabolism and could potentially serve as biomarkers for fatty liver disease and other related conditions. Further research is needed to fully understand the mechanisms by which these lncRNAs function and their potential clinical applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCUUCUCUUGCAGCUCGUGCAGCUUCUGGCGCGCGCCCUCUUGGAGCUCUGCGCGCAGCGGCUCCACCUUCUGGCGGUAGAGCUCCAUCUCCUCCUGCCACUUCUUCUGGAAGUCGUCCAGAUCCAAAUGGCAAACCUUCUUCAUCCACCAGGACCCAACCCACAGGCUACUUAUUGCUGGAAACCUACGUUGUUCCUUGGAUUGAAGUAAUCUCUCCCUCCUCUGGUGCGCCCACAGCACUUGCACCAACAGUGGGUACUCAACAGACUAGCGUGCCUGCCGAAGAAGGGGUCCUCUGACAAUCAGGGGACAAUGGGGAAUUAUGCUCUCCAGACUUUCUACACACACAAGUCACACAGGAAGGAAGGUAAAGAGAAACUAGAGAAAAUAAUUUUUGAAGAAAAACAUUUCAGGAAGUAUUGAAAGUACACGGUAACUCAGCCUGGGGCAGGGGUGGAGGGCAGCAGCACUGUUUGCUGCAGCUAUGCUCCUUCCUCAGUGCCCUGCACACCCGGGACUUGCUCGGUGAGCAUCUCUCGUGUCAGUGACAGCUAGUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications