Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1969 (LINC01969) URS00004FE11E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01969: LINC01969 is an oncogene that promotes the migration, proliferation, invasion, and epithelial-mesenchymal transition (EMT) of ovarian cancer (OC) cells through the miR-144-5p/LARP1 axis [PMC7889973]. LINC01969 is highly expressed in OC tissues and cell lines [PMC7889973]. It is associated with lower overall survival in OC patients [PMC7889973]. LINC01969 knockdown decreases LARP1 expression and OC cell EMT in vivo [PMC7889973]. It also affects OC cell invasion and migration [PMC7889973]. LINC01969 acts as a ceRNA for miR-144-5p to control LARP1 expression and promote the proliferation, migration, and invasion of OC cells [PMC7889973]. The interaction between miR-144-5p and LINC01969 has been confirmed through RIP assay [PMC7889973]. Knockdown of LINC01969 increases E-cadherin expression but decreases Snail and Vimentin expression levels in OC cells [PMC7889973]. The role of LINC01969 as a prognostic biomarker for OC has been suggested based on its association with clinical stage and prognosis [PMC7889973]. The subcellular distribution of LINC01969 is mainly cytoplasmic but with some signal detected in the nucleus [PMC7889973]. In addition to its role in OC, lncRNA H19 promotes hepatocellular carcinoma bone metastasis by mediating PPP1CA/p38MAPK-dependent reduction in OPG expression [PMID: 33473219]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGCAUGUGAUGUGUCCCAUCUCCCCUUCGGAUUGGAGGAAGAAGCUGUGUCCCUCCCAUCAGACAGACGGUCUCCUUAAAGAUUCUCCUGGUCUCCAGCUUGGGCUCUGCUGGAAAGAAGAGGAAGUAUUUAGCAAGGGUGAAGAUGGGUUCUUACUUCCCUGAGGCAACCAGAGAUAAGAAAAGACCAGAAUAUGAAUAUCCAGCAUUCCACAAAGAAUCCUACAGGCAGGGAUAUUGCCCAAUCACCAGUGCCUCGCAUCCCAGUUCUAUCCAAGAUCCAAGCUUGAUAUCCUCCUGAAAGACUUCCUGAAUCAGGUCACCAACAUGGACAUCUGAACUUCCAGAAUCAGGUCACCGUCUUUCUUCUCAUCUCUGGAUGUAUUUGGAGCUCAUUUGUCUGACGGUUUUUGAAUGCUAUCUUUUAAAAAUAAACUUUUACAAUUUGGGUUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications