Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-454-3p URS00004F77ED_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-454: Gga-mir-454 is a microRNA that has been found to inhibit the replication of infectious bursal disease virus (IBDV) by targeting the viral genomic segment B and enhancing the expression of interferon-beta (IFN-β) by targeting cellular SOCS6 [PMC7063076]. It has also been shown to inhibit myoblast differentiation and the expression of MyHC and MyoG genes [PMC7324647]. Gga-mir-454 has been found to be down-regulated during IBDV infection, and its overexpression enhances the expression of IFN-β, IRF3, and p65, thereby inhibiting IBDV replication [PMC9607458]. Gga-mir-454 can also target the viral genome B and SOCS6 to inhibit viral replication [PMC6862082]. In addition, gga-mir-454 has been found to be down-regulated in fat line chickens [PMC4326283]. Other microRNAs that target SOCS genes, such as gga-miR-155, gga-miR-130b, and gga-miR-21, have also been shown to inhibit IBDV replication [PMC9721073]. Overall, gga-mir-454 plays a significant role in inhibiting IBDV replication by targeting both viral genomic segments and cellular factors involved in immune response regulation. However, further research is needed to fully understand its mechanisms of action during IBDV infection.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGUGCAAUAUUGCUUAUAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Anolis carolinensis aca-miR-454-3p
  2. Bos taurus bta-miR-454
  3. Capra hircus chi-miR-454-3p
  4. Cervus elaphus (red deer) cel-miR-454
  5. Chiloscyllium plagiosum microRNA cpl-miR-454-3p
  6. Equus caballus eca-miR-454
  7. Gadus morhua gmo-miR-454-3p
  8. Homo sapiens (human) hsa-miR-454-3p
  9. Ictalurus punctatus ipu-miR-454b
  10. Macaca mulatta (Rhesus monkey) mml-miR-454-3p
  11. Nomascus leucogenys nle-miR-454
  12. Ornithorhynchus anatinus oan-miR-454-3p
  13. Pan troglodytes ptr-miR-454
  14. Sarcophilus harrisii (Tasmanian devil) sha-miR-454
  15. Sus scrofa ssc-miR-454
  16. Taeniopygia guttata (zebra finch) tgu-miR-454-3p
  17. Xenopus tropicalis xtr-miR-454-3p
Publications