Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-519e-3p URS00004F4C18_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-519e: Hsa-mir-519e is a miRNA that belongs to the miR-515 family and is coded in a cluster on 19q13.42 [PMC7648123]. It has been found to be upregulated in primary ACC [PMC5929417] and downregulated in preeclamptic placentas [PMC8666996]. Hsa-mir-519e is overmutated in Pan-Cancer, as well as in ovarian (OV) and breast (BRCA) cancers [PMC7648123]. It has been identified as a target gene of hsa_circRNA_0079201, along with other miRNAs such as hsa-miR-140-3P and hsa-miR-1225-3P [PMC7595675]. Hsa-mir-519e is expressed at low to medium levels in THYM, BLCA, and TGCT cancers [PMC7648123]. In the context of PTCL/NOS, ALCL/ALK−, and AITL cancers, hsa-mir-519e has been found to be differentially expressed along with other miRNAs such as hsa-miR-515-3p and hsa-miR-652 [PMC4335255]. In addition, it has been shown that the upregulation of hsa-mir-519e is associated with downregulation of its potential targets ATR and PYHIN1 [PMC3886917]. RFC4, ZWINT, TYMS were identified as hub genes associated with GBM tumorigenicity along with transcription factors TATA-binding protein (TATA), E2F transcription factor 4 (E2F4DP1), and hepatocyte nuclear factor 4 (HFH4) [PMC6180049].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGUGCCUCCUUUUAGAGUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla ggo-miR-519e-3p (MIR519E)
  2. Gorilla gorilla (western gorilla) ggo-miR-519e-3p
  3. Pan troglodytes ptr-miR-519e
  4. Pongo pygmaeus ppy-miR-519e
Publications