Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-145 precursor URS00004F4657_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR145: MIR145 is a microRNA that has been found to be involved in various biological processes and diseases. In diabetic nephropathy (DN) patients, MIR145 levels were significantly higher in urinary extracellular vesicles (uEVs) compared to normoalbuminuric patients, and its levels further increased with the development of proteinuria [PMC9603196]. MIR145 is transcribed as a single precursor molecule along with Mir143 and is known to regulate stem cell pluripotency [PMC7956570]. In mice, the loss of Sox2 leads to an increase in MIR145 levels, which subsequently reduces Sox9 protein levels [PMC3865748]. Promoter hypermethylation of MIR145 has been observed in pituitary tumors compared to normal tissue [PMC7281098]. A logistic regression model including miR-7, miR-126, and MIR145 showed promising results in distinguishing non-small cell lung cancer (NSCLC) patients from controls [PMC6463117]. In an experimental study using mice, the injection of MIR145 into tumors resulted in a reduction in tumor volume [PMC5297811]. Additionally, upregulation of MIR145 has been observed in the blood of patients with idiopathic pulmonary arterial hypertension (IPAH) [PMC4357130]. Furthermore, alterations in the expression of MIR145 have been found upon doxorubicin treatment in breast cancer cells [PMC6679136]. The miR-17-92 cluster has also been shown to promote lung progenitor proliferation [PMC4304179]. Finally, MIR145 has potential as a candidate biomarker for breast cancer diagnosis and its oral application along with other tumor suppressor miRs showed promising results for blocking colon cancer tumorigenesis in mice [PMC6786248] [PMC7147085].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 52 other species

  1. Ailuropoda melanoleuca microRNA 145 (ENSAMEG00000020814.2)
  2. Aotus nancymaae microRNA 145 (ENSANAG00000005543.1)
  3. Artibeus jamaicensis microRNA aja-mir-145 precursor
  4. Balaenoptera musculus microRNA 145 (ENSBMSG00010000932.1)
  5. Bison bison bison microRNA 145 (ENSBBBG00000024584.1)
  6. Bos grunniens microRNA 145 (ENSBGRG00000019262.1)
  7. Bos indicus x Bos taurus (hybrid cattle) miRNA (ENSBIXG00000026819.1, ENSBIXG00005007667.1)
  8. Bos mutus microRNA 145 (ENSBMUG00000014905.1)
  9. Bos taurus microRNA bta-mir-145 precursor
  10. Camelus dromedarius microRNA 145 (ENSCDRG00005002968.1)
  11. Capra hircus microRNA chi-mir-145 precursor
  12. Cebus imitator microRNA 145 (ENSCCAG00000007409.1)
  13. Cervus hanglu yarkandensis (Yarkand deer) microRNA 145 (ENSCHYG00000003752.1)
  14. Delphinapterus leucas (beluga whale) microRNA 145 (ENSDLEG00000003977.1)
  15. Echinops telfairi microRNA 145 (ENSETEG00000020894.1)
  16. Equus asinus asinus microRNA 145 (ENSEASG00005002858.1)
  17. Equus asinus microRNA 145 (ENSEASG00005002858.2)
  18. Equus caballus microRNA 145 (ENSECAG00000026203.2)
  19. Felis catus microRNA 145 (ENSFCAG00000026678.3)
  20. Gorilla gorilla gorilla ggo-mir-145 (ENSGGOG00000028933.2)
  21. Gorilla gorilla (western gorilla) microRNA ggo-mir-145 precursor
  22. Loxodonta africana (African savanna elephant) microRNA 145 (ENSLAFG00000029552.1)
  23. Lynx canadensis microRNA 145 (ENSLCNG00005006296.1)
  24. Microcebus murinus microRNA 145 (ENSMICG00000018191.3)
  25. Monodon monoceros (narwhal) microRNA 145 (ENSMMNG00015001524.1)
  26. Moschus moschiferus (Siberian musk deer) microRNA 145 (ENSMMSG00000000428.1)
  27. Mustela putorius furo (Domestic ferret) microRNA 145 (ENSMPUG00000021486.1)
  28. Neogale vison microRNA 145 (ENSNVIG00000001711.1)
  29. Nomascus leucogenys microRNA 145 (ENSNLEG00000020983.2)
  30. Ovis aries (sheep) miRNA (ENSOARG00000024033.1, ENSOARG00020009871.2)
  31. Pan paniscus (bonobo) microRNA 145 (ENSPPAG00000019447.1)
  32. Panthera leo microRNA 145 (ENSPLOG00000002119.1)
  33. Panthera pardus microRNA 145 (ENSPPRG00000013729.1)
  34. Panthera tigris altaica microRNA 145 (ENSPTIG00000003046.1)
  35. Pan troglodytes microRNA ptr-mir-145 precursor
  36. Phocoena sinus (vaquita) microRNA 145 (ENSPSNG00000019401.1)
  37. Physeter catodon microRNA 145 (ENSPCTG00005000302.1)
  38. Pongo abelii (Sumatran orangutan) microRNA 145 (ENSPPYG00000021565.2)
  39. Pongo pygmaeus microRNA ppy-mir-145 precursor
  40. Prolemur simus microRNA 145 (ENSPSMG00000024243.1)
  41. Saimiri boliviensis boliviensis microRNA 145 (ENSSBOG00000000901.1)
  42. Tupaia belangeri microRNA 145 (ENSTBEG00000017862.1)
  43. Tursiops truncatus (bottlenosed dolphin) microRNA 145 (ENSTTRG00000023926.1)
  44. Ursus americanus (American black bear) microRNA 145 (ENSUAMG00000019596.1)
  45. Ursus maritimus microRNA 145 (ENSUMAG00000005415.1)
  46. Ursus thibetanus thibetanus microRNA 145 (ENSUTTG00000001524.1)
  47. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015001106.1)
Publications