Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-96 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-96 precursor URS00004E4AD0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR96: MIR96 is a microRNA that has been found to be associated with progressive hearing loss [PMC3259013]. Understanding the pathogenic mechanisms that connect MIR96 mutations to this condition is crucial for the development of personalized therapeutic approaches for individuals carrying these mutations [PMC3259013]. However, there is insufficient coverage of MIR96, which may limit our current knowledge about its role in hearing loss [PMC8738750]. Further research is needed to fully comprehend the impact of MIR96 mutations and to explore potential therapeutic interventions for affected individuals.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAAUCAUGUGCAGUGCCAAUAUGGGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Ailuropoda melanoleuca microRNA mir-96
  2. Aotus nancymaae microRNA 96 (ENSANAG00000008419.1)
  3. Camelus ferus microRNA mir-96
  4. Canis lupus familiaris (dog) microRNA mir-96
  5. Cebus imitator microRNA 96 (ENSCCAG00000032226.1)
  6. Cercocebus atys microRNA 96 (ENSCATG00000017613.1)
  7. Chlorocebus sabaeus microRNA 96 (ENSCSAG00000027483.1)
  8. Colobus angolensis palliatus miRNA (ENSCANG00000017438.1)
  9. Cricetulus griseus (Chinese hamster) microRNA mir-96
  10. Equus caballus microRNA eca-mir-96 precursor
  11. Felis catus microRNA mir-96
  12. Gorilla gorilla gorilla ggo-mir-96 (ENSGGOG00000033498.2)
  13. Gorilla gorilla microRNA ggo-mir-96 precursor
  14. Heterocephalus glaber (naked mole-rat) microRNA mir-96
  15. Macaca mulatta microRNA mml-mir-96 precursor
  16. Macaca nemestrina microRNA mne-mir-96 precursor
  17. Mandrillus leucophaeus microRNA 96 (ENSMLEG00000014734.1)
  18. Microcebus murinus (gray mouse lemur) microRNA 96 (ENSMICG00000018034.3)
  19. Nomascus leucogenys microRNA 96 (ENSNLEG00000024063.2)
  20. Oryctolagus cuniculus microRNA mir-96
  21. Otolemur garnettii microRNA 96 (ENSOGAG00000019646.1)
  22. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-96 precursor
  23. Panthera pardus microRNA 96 (ENSPPRG00000013914.1)
  24. Panthera tigris altaica microRNA 96 (ENSPTIG00000002766.1)
  25. Pan troglodytes microRNA ptr-mir-96 precursor
  26. Papio anubis microRNA mir-96
  27. Pongo abelii microRNA mir-96
  28. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-96 precursor
  29. Procavia capensis microRNA 96 (ENSPCAG00000019066.1)
  30. Propithecus coquereli microRNA 96 (ENSPCOG00000000790.1)
  31. Rattus norvegicus (Norway rat) microRNA mir-96
  32. Rhinopithecus bieti miRNA (ENSRBIG00000012352.1)
  33. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 96 (ENSRROG00000011119.1)
  34. Saimiri boliviensis boliviensis microRNA 96 (ENSSBOG00000019334.1)
  35. Ictidomys tridecemlineatus microRNA mir-96
  36. Vulpes vulpes microRNA 96 (ENSVVUG00000012369.1)
2D structure Publications