Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-769-5p URS00004E008F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-769: Hsa-mir-769 is a microRNA that is not conserved in mice and does not have a potential cleavage role [PMC3333847]. In breast adenocarcinoma cell line MCF-7, hsa-mir-769 has been found to inhibit the expression of N-myc downstream-regulated gene 1 and enhance apoptosis [PMC6208346]. Hsa-mir-769, along with hsa-miR-200c, hsa-miR-1185, and hsa-miR-146b, has been associated with breast cancer prognosis [PMC6208346]. Hsa-mir-769 has also been found to be differentially expressed in male breast cancers and between African-American and non-Hispanic white women with triple negative breast cancer [PMC6208346]. In African-American women with triple negative breast cancer, hsa-mir-769 was upregulated compared to non-Hispanic white women [PMC6208346]. The expression levels of hsa-mir-769 in the early stage group of breast cancer patients were 4.88 ± 0.70, while in the advanced stage group it was 4.75 ± 0.77 [PMC6208346].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGACCUCUGGGUUCUGAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Publications