Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4449 URS00004DE2FC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4449: Hsa-mir-4449 is a microRNA that has been found to be significantly down-regulated in the peripheral blood of patients with non-small cell lung cancer (NSCLC) [PMC8294502]. In patients with lung transplantation (LT) rejection, hsa-mir-4449 has shown a significant rise in expression, along with hsa-miR-548as-3p and -3158-5p [PMC8199419]. Additionally, hsa-mir-4449 has been found to be downregulated in the good response group of patients, along with hsa-miR-135a-5p, hsa-miR-4488, and hsa-miR-122-5p [PMC8313935]. Hsa-mir-4449 has also been identified as a diagnostic or prognostic biomarker in glioma [PMC9983174]. In a study using cell lines, the expression of hsa-mir-4449 was significantly upregulated after treatment with CAP [PMC8851033]. Furthermore, hsa-mir-4449 has been found to regulate IL1β and IL18 expressions, as well as the level of ROS and pyroptosis in diabetic kidney disease (DKD) pathogenesis [PMC9761943]. Hsa-mir-4449 is also implicated in kidney disease pathogenesis and development along with hsa-circ_0001250 and hsa-miR639 [PMC9761943]. Bioinformatics methods have identified six miRNAs including hsa-mir-4449 that may have potential roles in disease pathogenesis [PMC9473890]. Finally, osteoporotic samples have shown upregulation of 13 miRNAs including hsa-mir 4449 compared to osteoarthritic samples [PMC7543140].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGUCCCGGGGCUGCGCGAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications