Homo sapiens (human) ELMO1 antisense RNA 1 (ELMO1-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ELMO1 antisense RNA 1 (ELMO1-AS1) URS00004DC63E_9606

528 nucleotides
7 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, RefSeq)
Found in 0 other species
7 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ELMO1-AS1: ELMO1-AS1 is a regulatory element in hepatocellular carcinoma (HCC) [PMC6689543]. It has been found to play an important role in the regulation of HCC [PMC6689543]. Additionally, univariate and multivariate analyses of clinicopathological features have shown that the expression of ELMO1-AS1 is an independent protective factor for overall survival (OS) and disease-free survival (DFS) in HCC patients [PMC6689543]. This suggests that ELMO1-AS1 could potentially serve as a prognostic biomarker for HCC [PMC6689543].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AGUGCCAUGGGAAUGAGGAAUGGAGAGGAUCCCAGGAAGCACAGGAGGCAACACAAGUCAAUGCCUCAGAGCCAGGGAACAGGAUGAACAAGAACAAUCAGAAGAUGACCUUGAGCUAAAUGAAGCAAUUGCAGCAGAUCUACAGGUCAGCUGAGGUGGCUCUUUCAAGCUCUGUGGGCUGACUGGAAAAACUGCGCUCCAUAUAUCUCAUUUUGGGACCUACACUGAAGGAGCAGUGGCUACCAAGGAGCUGGAUACAGAUGCAGAAAAACUCCUCAAAGGAUCUGUCGUGGGUGAAGAACAUCGGGUGGAAGUCGUUGCAGGUCUCACUAGCUGGAGGAAAGAGAUGGAAAAUAAGAGAAAAAGUUUUAAAACAGUGAAACACGAGAACAUAACCACAGGUAUGUGCCCCAAAGGGAGACAAGCGGAGGUAUCUUUGGUUCAGGCAAUAAUGGUGAAAAAGUAUUUUUGAAAAAAGCAACCAAAGGAUGGCCCCCAUACAACUCGGAAGUUUAAGGCCAGAUAGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications