Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-610 URS00004DC583_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-610: Hsa-mir-610 is a microRNA that has been found to be downregulated by mutp53 and upregulated by wtp53 [PMC4905457]. It is one of two miRNAs that are overexpressed in patients with good prognosis, suggesting it could serve as a biomarker for favorable outcomes [PMC9732100]. In addition, hsa-mir-610 has been identified as one of several miRNAs that are dysregulated in different conditions. For example, it is upregulated in the P alone group and the P + E support group [PMC3462109]. It is also overexpressed in the progesterone support group [PMC3462109]. Furthermore, hsa-mir-610 has been included in a miRNA‒mRNA network constructed using Cytoscape [PMC9676937]. Hsa-mir-610 primer was obtained from Genecopoeia for experimental purposes [PMC5722568]. In another study, hsa-mir-610 was found to be downregulated in primary ACC compared to normal salivary gland tissue [PMC5929417]. Additionally, hsa-mir-610 has been identified as one of several miRNAs that show dysregulation in both serum and cerebrospinal fluid (CSF) but with opposing dysregulation patterns between the two fluids [PMC9738832]. Overall, hsa-mir-610 plays a role in various biological processes and may have diagnostic or prognostic potential.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGCUAAAUGUGUGCUGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications