Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 62A (SNORD62A, SNORD62B) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 62A (SNORD62A, SNORD62B) URS00004D7B5D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD62A: SNORD62A is a small nucleolar RNA (snoRNA) that has been studied in various contexts. In a study using confirmatory samples, the presence and selective sensitivity to NSUN2 KD were confirmed for four sites in ncRNAs, including SNORD62A [PMC7158060]. Another study explored six candidate m5C sites using two prostate cell lines, and evidence of non-conversion was observed in SNORD62A [PMC7158060]. The sites in RPPH1, SCARNA2, NSNU5P2, and SNORD62A were further validated in independent biological samples [PMC7158060]. In the context of invasive breast cancer, SNORD62A was among the most highly upregulated snoRNAs in the MDA-MB-231 cell line [PMC8445368]. The binding of 15.5k protein to SNORD62A snoRNA was explored with and without N6 methylation of A1n using isothermal titration calorimetry [PMC5579392]. Overall, these studies highlight the presence and sensitivity of SNORD62A to various factors such as NSUN2 KD and methylation.

SNORD62B: SNORD62B is a small nucleolar RNA (snoRNA) that has been studied in various contexts [PMC7158060]. In a study using confirmatory samples, the presence and selective sensitivity to NSUN2 KD (knockdown) were confirmed for four sites in ncRNAs, including SNORD62B [PMC7158060]. The sites in SNORD62B, along with other ncRNAs and mRNAs, were further validated in independent biological samples [PMC7158060]. Non-conversion was observed in SNORD62B, indicating the presence of modified nucleotides [PMC7158060]. Additionally, SNORD62B was found to be differentially expressed and highly upregulated in invasive breast cancer cell lines [PMC8445368]. The binding of 15.5k protein to SNORD62B snoRNA was explored using isothermal titration calorimetry [PMC5579392].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAGUGAUGUAAUUCCAAUAGAUCCUUCUGACCCUCCACUGUGGACUCAAUAGCAGGGAGAUGAAGAGGACAGUGACUGAGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

2D structure Publications